About the Primer Melting Temperature Calculator
This primer melting temperature (Tm) calculator estimates the temperature at which half of a DNA oligonucleotide is bound to its complementary strand. Paste a primer sequence and it reports the Tm from four methods side by side: the SantaLucia (1998) nearest-neighbor model with a sodium correction, the salt-adjusted GC formula, the basic GC formula and the quick Wallace rule (2 °C per A/T, 4 °C per G/C).
It is meant for designing and pairing PCR primers, qPCR assays and sequencing primers. Matching the Tm of forward and reverse primers within about 2–5 °C and choosing an annealing temperature a few degrees below the lower Tm are standard rules of thumb. GC content, duplex ΔH, ΔS and ΔG at 37 °C are shown as well.
The nearest-neighbor Tm assumes a perfectly matched duplex, the primer concentration you enter (with the C/4 term used by Primer3 for non-self-complementary oligos), and monovalent cations as given. Magnesium is converted to a sodium equivalent with the von Ahsen approximation (Na⁺ + 120√Mg²⁺, in mM, ignoring dNTP binding). Different tools use different parameter sets and salt corrections, so Tm values can differ by a few degrees — compare primers within one method.
With the default inputs, the tm, nearest-neighbor (santalucia 1998) is 57.5 °C. Change any value above to recalculate instantly.
How to use the primer melting temperature calculator
- 1Paste the primer sequence 5′→3′ (spaces and numbers are ignored).
- 2Enter the monovalent salt concentration of your buffer (50 mM is typical).
- 3Add Mg²⁺ if your PCR buffer contains it, and the primer concentration.
- 4Read the nearest-neighbor Tm and compare it with the simpler estimates.
- 5Match forward and reverse primer Tm within a few degrees and anneal a few degrees below.
Formula and method
The nearest-neighbor method sums the enthalpy and entropy of every overlapping base-pair step (AA/TT, GC/CG and so on) using the SantaLucia (1998) unified parameters, adds initiation terms for terminal G·C or A·T pairs, and applies the SantaLucia entropy salt correction 0.368 × (N − 1) × ln[Na⁺]. The Tm is where half the strands are duplexed, which depends on strand concentration C: C/4 is used for non-self-complementary primers and C for palindromes (with a −1.4 cal/(K·mol) symmetry term).
The simpler formulas use only base counts: basic Tm = 64.9 + 41 × (G + C − 16.4) ÷ N for N ≥ 14, salt-adjusted Tm = 100.5 + 41 × (G + C) ÷ N − 820 ÷ N + 16.6 × log₁₀[Na⁺], and the Wallace rule for short oligos. Concentrations are in mol/L inside the logarithms.
- ΔH, ΔS
- Duplex enthalpy (kcal/mol) and entropy (cal/(K·mol))
- N
- Primer length in nucleotides
- [Na⁺]
- Monovalent cation concentration, mol/L (plus 120√[Mg²⁺] in mM terms)
- C
- Primer (oligo) concentration, mol/L
- R
- Gas constant, 1.987 cal/(K·mol)
Worked examples
M13 reverse primer (24 nt), 50 mM Na⁺, 500 nM
AGCGGATAACAATTTCACACAGGA has 10 G/C and 14 A/T bases. Summing the 23 nearest-neighbor steps plus end terms gives ΔH = −184.4 kcal/mol and a salt-corrected ΔS = −526.1 cal/(K·mol), so Tm ≈ 57.5 °C. The Wallace rule (2 × 14 + 4 × 10 = 68 °C) overestimates for a primer this long.
M13 forward (−20) primer, 17 nt
With 9 G/C and 8 A/T bases the Wallace rule gives 2 × 8 + 4 × 9 = 52 °C. The nearest-neighbor model gives 52.8 °C at 50 mM Na⁺ and 500 nM primer, and the basic formula 64.9 + 41 × (9 − 16.4) ÷ 17 = 47.1 °C.
Same primer in PCR buffer with 1.5 mM Mg²⁺
Magnesium stabilises the duplex. Its sodium equivalent is 50 + 120 × √1.5 ≈ 197 mM, which raises the nearest-neighbor Tm from 52.8 °C to about 59.3 °C — why PCR annealing temperatures are often higher than salt-free estimates suggest.
Frequently asked questions
What is primer Tm?+
The melting temperature is the temperature at which half of the primer molecules are annealed to their complementary sequence and half are single-stranded. It depends on length, GC content, sequence order, salt and primer concentration.
Which Tm formula is most accurate?+
The nearest-neighbor model is the most accurate because it accounts for sequence order, not just base counts, and for salt and strand concentration. The Wallace rule is only a rough guide for primers of about 14–20 nt.
How do I choose an annealing temperature from Tm?+
A common starting point is 3–5 °C below the lower Tm of the primer pair, then optimising with a gradient PCR. Some polymerase suppliers recommend their own calculators because their buffers differ.
Why do different Tm calculators give different answers?+
They use different thermodynamic parameter sets, salt corrections, magnesium handling and concentration terms. Differences of 2–5 °C are normal. Always compare primers using the same calculator and settings.
What GC content should a primer have?+
Most guidelines suggest 40–60% GC and a G or C at the 3′ end (a GC clamp) without more than three G/C in the last five bases. This keeps Tm in a useful range and reduces mispriming.